Inferring multimodal latent topics from electronic health records

Immuno-Informatics Quest against COVID-19/SARS-COV-2: Determining Putative T-Cell Epitopes for Vaccine Prediction

Electronic health records (EHR) are wealthy heterogeneous collections of affected person health data, whose broad adoption gives clinicians and researchers unprecedented alternatives for health informatics, disease-risk prediction, actionable scientific suggestions, and precision drugs. However, EHRs current a number of modeling challenges, together with extremely sparse knowledge matrices, noisy irregular scientific notes, arbitrary biases in billing code project, diagnosis-driven lab checks, and heterogeneous knowledge varieties. To handle these challenges, we current MixEHR, a multi-view Bayesian subject mannequin. We exhibit MixEHR on MIMIC-III, Mayo Clinic Bipolar Disorder, and Quebec Congenital Heart Disease EHR datasets.

Qualitatively, MixEHR illness topics reveal significant combos of scientific options throughout heterogeneous knowledge varieties. Quantitatively, we observe superior prediction accuracy of diagnostic codes and lab take a look at imputations in comparison with the state-of-art strategies. We leverage the inferred affected person subject mixtures to categorise goal illnesses and predict mortality of sufferers in crucial circumstances. In all comparability, MixEHR confers aggressive efficiency and divulges significant disease-related topics.

The explosive progress of machine studying has offered scientists with insights into knowledge in methods unattainable utilizing prior analysis methods. It has allowed the detection of organic options that had been beforehand unrecognized and missed. However, as a result of machine-learning methodology originates from informatics, many cell biology labs have skilled difficulties in implementing this strategy.

In this text, we goal the quickly increasing viewers of cell and molecular biologists thinking about exploiting machine studying for evaluation of their analysis. We focus on the benefits of using machine studying with microscopy approaches and describe the machine-learning pipeline. We additionally give sensible tips for constructing fashions of cell conduct utilizing machine studying. We conclude with an summary of the instruments required for mannequin creation, and share recommendation on their use.

Cloud-Based System for Effective Surveillance and Control of COVID-19: Useful Experiences From Hubei, China.

Coronavirus illness (COVID-19) has been an unprecedented problem to the worldwide health care system. Tools that may enhance the main focus of surveillance efforts and scientific resolution help are of paramount significance. To illustrate how new medical informatics applied sciences will allow efficient management of the pandemic, the Honghu Hybrid System (HHS) for COVID-19 was developed and efficiently deployed inside 72 hours within the metropolis of Honghu in Hubei, China.

The HHS was designed for the gathering, integration, standardization, and evaluation of COVID-19-related knowledge from a number of sources, which features a case reporting system, diagnostic labs, electronic medical records, and social media on cellular units. HHS helps 4 most important options: syndromic surveillance on cellular units, policy-making resolution help, scientific resolution help and prioritization of assets, and follow-up of discharged sufferers.

The syndromic surveillance part in HHS coated over 95% of the inhabitants of over 900,000 individuals and offered close to actual time proof for the management of epidemic emergencies. The scientific resolution help part in HHS was additionally offered to enhance affected person care and prioritize the restricted medical assets. However, the statistical strategies nonetheless require additional evaluations to verify scientific effectiveness and appropriateness of disposition assigned on this examine, which warrants additional investigation. The facilitating elements and challenges are mentioned to offer helpful insights to different cities to construct appropriate options primarily based on cloud applied sciences.

The HHS for COVID-19 was proven to be possible and efficient on this real-world subject examine, and has the potential to be migrated. The explosive progress of machine studying has offered scientists with insights into knowledge in methods unattainable utilizing prior analysis methods. It has allowed the detection of organic options that had been beforehand unrecognized and missed. However, as a result of machine-learning methodology originates from informatics, many cell biology labs have skilled difficulties in implementing this strategy.

In this text, we goal the quickly increasing viewers of cell and molecular biologists thinking about exploiting machine studying for evaluation of their analysis. We focus on the benefits of using machine studying with microscopy approaches and describe the machine-learning pipeline. We additionally give sensible tips for constructing fashions of cell conduct utilizing machine studying. We conclude with an summary of the instruments required for mannequin creation, and share recommendation on their use.

 Immuno-Informatics Quest against COVID-19/SARS-COV-2: Determining Putative T-Cell Epitopes for Vaccine Prediction

Emerging Technologies to Bring Glycoproteomics Within Reach.

The NIH Common Fund Glycoscience program develops accessible and inexpensive new instruments for carbohydrate evaluation, informatics, and synthesis. The program emphasizes simple applied sciences attentive to wants expressed by finish person teams from a number of fields. Validation and value testing in partnering labs ensures that instruments are accessible to non-specialists. This session will describe instruments rising from the Glycoscience program and clarify how useful resource services can entry these instruments and convey them in-house. Our aim is for assets to broaden their impression in glycomics, glycoproteomics, and glycoscience usually, by adoption of simple, dependable artificial, analytical, and informatics instruments that we’re growing.

Three Scientific Sessions will describe instruments rising from the Glycoscience program, in three classes: (1) glycan evaluation, together with mass spectrometric methods for construction willpower and glycoproteomics; (2) glycan synthesis; and (3) glycoinformatics. Analytical applied sciences to be described embrace: excessive throughput permethylation of glycopeptides by way of one-pot for website mapping and glycan evaluation

Isotope-targeted glycoproteomics (IsoTaG), a mass-independent chemical glycoproteomics method for profiling glycopeptides, figuring out each N- and O-glycan constructions and websites of attachment in advanced samples; facile strategies to extremely purify glycans; software program instruments for constructing 3D fashions of glycoproteins and predicting the 3D construction of glycans; a variety of extremely versatile glycan affinity reagents, together with sialoglycan-recognizing probes; and new photo-crosslinking probes for discovery of the interplay companions of O-GlcNAc modified proteins.

ABHD1 Polyclonal Antibody

ABP57663-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABHD1 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of ABHD1 from Human, Mouse, Rat. This ABHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABHD1 protein at amino acid sequence of 220-300

ABHD1 Polyclonal Antibody

ES9333-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABHD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABHD1 Polyclonal Antibody

ES9333-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABHD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Abhd1/ Rat Abhd1 ELISA Kit

ELI-49473r 96 Tests
EUR 886

Polyclonal ABHD1 Antibody (C-term)

APR04321G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ABHD1 (C-term). This antibody is tested and proven to work in the following applications:

ABHD1 Antibody

36009-100ul 100ul
EUR 252

ABHD1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABHD1. Recognizes ABHD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ABHD1 Antibody

DF9140 200ul
EUR 304
Description: ABHD1 Antibody detects endogenous levels of total ABHD1.

ABHD1 antibody

70R-8853 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ABHD1 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABHD1 Antibody

ABD9140 100 ug
EUR 438


YF-PA21459 50 ug
EUR 363
Description: Mouse polyclonal to ABHD1

ABHD1 Blocking Peptide

33R-3428 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABHD1 antibody, catalog no. 70R-8853

ABHD1 Blocking Peptide

DF9140-BP 1mg
EUR 195

ABHD1 Conjugated Antibody

C36009 100ul
EUR 397

ABHD1 cloning plasmid

CSB-CL842760HU-10ug 10ug
EUR 451
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1218
  • Sequence: atgctgagctccttcctgagcccccagaatggcacctgggcagacaccttctctctgctcttggctcttgccgttgccctctacttgggctactactgggcatgtgtgcttcagaggcctcggctggtggctgggccgcagtttctggccttcctggagccacactgttccatca
  • Show more
Description: A cloning plasmid for the ABHD1 gene.

anti- ABHD1 antibody

FNab00044 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: abhydrolase domain containing 1
  • Uniprot ID: Q96SE0
  • Gene ID: 84696
  • Research Area: Metabolism
Description: Antibody raised against ABHD1

Anti-ABHD1 antibody

PAab00044 100 ug
EUR 386

Anti-ABHD1 antibody

STJ190491 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABHD1


EF007535 96 Tests
EUR 689

Rat ABHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ABHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16780 2 ug
EUR 325

ABHD1 Recombinant Protein (Human)

RP000115 100 ug Ask for price

ABHD1 Recombinant Protein (Mouse)

RP113426 100 ug Ask for price

ABHD1 Recombinant Protein (Rat)

RP188639 100 ug Ask for price

Rabbit Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E04A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E04A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E04A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Abhd1 ORF Vector (Rat) (pORF)

ORF062881 1.0 ug DNA
EUR 506

ABHD1 ORF Vector (Human) (pORF)

ORF000039 1.0 ug DNA
EUR 95

Abhd1 ORF Vector (Mouse) (pORF)

ORF037810 1.0 ug DNA
EUR 506

Abhydrolase Domain Containing 1 (ABHD1) Antibody

abx030344-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Abhydrolase Domain Containing 1 (ABHD1) Antibody

abx030344-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Abhydrolase Domain Containing 1 (ABHD1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Abhydrolase Domain Containing 1 (ABHD1) Antibody

abx230044-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Abhd1 sgRNA CRISPR Lentivector set (Rat)

K7243701 3 x 1.0 ug
EUR 339

ABHD1 sgRNA CRISPR Lentivector set (Human)

K0022101 3 x 1.0 ug
EUR 339

Abhd1 sgRNA CRISPR Lentivector set (Mouse)

K3896901 3 x 1.0 ug
EUR 339

Abhd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7243702 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7243703 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7243704 1.0 ug DNA
EUR 154

ABHD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0022102 1.0 ug DNA
EUR 154

ABHD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0022103 1.0 ug DNA
EUR 154

ABHD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0022104 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3896902 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3896903 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3896904 1.0 ug DNA
EUR 154

ABHD1 Protein Vector (Mouse) (pPB-C-His)

PV151238 500 ng
EUR 603

ABHD1 Protein Vector (Mouse) (pPB-N-His)

PV151239 500 ng
EUR 603

ABHD1 Protein Vector (Mouse) (pPM-C-HA)

PV151240 500 ng
EUR 603

ABHD1 Protein Vector (Mouse) (pPM-C-His)

PV151241 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPB-C-His)

PV251522 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPB-N-His)

PV251523 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPM-C-HA)

PV251524 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPM-C-His)

PV251525 500 ng
EUR 603

ABHD1 Protein Vector (Human) (pPB-His-MBP)

PV318890 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPB-His-GST)

PV318891 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPB-C-His)

PV000153 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPB-N-His)

PV000154 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPM-C-HA)

PV000155 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPM-C-His)

PV000156 500 ng
EUR 329

Abhd1 3'UTR Luciferase Stable Cell Line

TU101178 1.0 ml Ask for price

Abhd1 3'UTR GFP Stable Cell Line

TU151178 1.0 ml Ask for price

Abhd1 3'UTR Luciferase Stable Cell Line

TU200085 1.0 ml Ask for price

Abhd1 3'UTR GFP Stable Cell Line

TU250085 1.0 ml Ask for price

ABHD1 3'UTR GFP Stable Cell Line

TU050092 1.0 ml
EUR 1394

ABHD1 3'UTR Luciferase Stable Cell Line

TU000092 1.0 ml
EUR 1394

Human Abhydrolase Domain Containing 1 (ABHD1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

ABHD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV673117 1.0 ug DNA
EUR 682

ABHD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV673121 1.0 ug DNA
EUR 682

ABHD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV673122 1.0 ug DNA
EUR 682

Rat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E02A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E02A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E02A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E06A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E06A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E06A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E03A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E03A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E03A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E01A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E01A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E01A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E08A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E08A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E08A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E09A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E09A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E09A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E07A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E07A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E07A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain- containing protein 1, Abhd1 ELISA KIT

ELI-24638m 96 Tests
EUR 865

Bovine Abhydrolase domain- containing protein 1, ABHD1 ELISA KIT

ELI-34988b 96 Tests
EUR 928

Chemical and enzymatic schemes for the facile automated synthesis of carbohydrates (N- linked, O-linked, human milk, GAGs, glycolipids) can be found to core services to carry in-house utilizing present instrumentation or new low-cost modular automation platforms. Glycoinformatics instruments and strategies are being developed in a community-based effort, integrating them with well-established genomic and proteomic databases and instruments at NCBI and EBI. The venture entails 10 groups in 5 international locations.

There were some clues’: a qualitative study of heuristics used by parents of adolescents to make credibility judgements of online health news articles citing research

Immuno-Informatics Quest against COVID-19/SARS-COV-2: Determining Putative T-Cell Epitopes for Vaccine Prediction
 To determine how parents decide the credibility of online health news tales with hyperlinks to scientific research. This qualitative study interviewed parents who learn online tales about e-cigarettes and human papillomavirus (HPV) vaccination printed by top-tier US news organisations. Researchers requested members to describe parts of a story that influenced their judgement about content material credibility. Researchers analysed transcripts utilizing inductive and deductive methods. Deductive evaluation drew on cognitive heuristics beforehand recognized as being used by the general public to decide online health info.
Sixty-four parents with a minimum of one baby between the ages of 9 and 17 residing in Maryland, Virginia, or the District of Columbia participated. Researchers randomly assigned 31 parents to the HPV vaccination story and 33 to the e-cigarette story. Evidence of present heuristics, together with repute, endorsement, consistency, self-confirmation, expectancy violation and persuasive intent emerged from the interviews, with members deeming tales credible when mentioning physicians (repute heuristic) and/or per info supplied by private physicians (consistency heuristic).
Participants additionally described making credibility judgements primarily based on presence of statistics, hyperlinks to scientific research and their normal emotions about news media. In relation to presence of statistics and hyperlinks, members reported these parts elevated the credibility of the news story, whereas their emotions in regards to the news media decreased their credibility judgement. Inductive evaluation allowed the emergence of new heuristics, particularly relating to health.  
Parents used a constellation of heuristics to decide the credibility of online health news tales. Previously recognized heuristics for online health info are additionally relevant within the context of health news tales. The findings have implications for initiatives in training, health communication and journalism directed in the direction of growing the general public’s engagement with health news and their credibility judgements. In this paper, the use of iLAB in a bioprocess improvement utility is described. Process parameters and measured values of two high-throughput bioreactor methods (96-well plates and 10 mL reactor vessels) are collected within the iLAB database.

Continuous Detection of Physiological Stress with Commodity Hardware

Timely detection of a person’s stress stage has the potential to enhance stress administration, thereby decreasing the danger of adversarial health penalties which will come up due to mismanagement of stress. Recent advances in wearable sensing have resulted in a number of approaches to detect and monitor stress with various ranges of accuracy. The most correct strategies, nonetheless, depend on clinical-grade sensors to measure physiological alerts; they’re usually cumbersome, customized made, and costly, therefore limiting their adoption by researchers and most of the people. In this text, we discover the viability of commercially available off-the-shelf sensors for stress monitoring.

The thought is to give you the chance to use low cost, nonclinical sensors to seize physiological alerts and make inferences in regards to the wearer’s stress stage primarily based on that knowledge. We describe a system involving a fashionable off-the-shelf coronary heart charge monitor, the Polar H7; we evaluated our system with 26 members in each a managed lab setting with three well-validated stress-inducing stimuli and in free-living discipline situations. Our evaluation reveals that utilizing the off-the-shelf sensor alone, we were ready to detect annoying occasions with an Flab and 0.66 within the discipline, on par with clinical-grade sensors.

With the event of healthcare 4.0, there was an explosion within the quantity of knowledge reminiscent of picture, medical textual content, physiological alerts, lab exams, and many others. Among them, medical information present a full image of the related scientific occasions. However, the processing of medical texts is troublesome as a result of they’re structurally free, various in fashion, and have subjective components.

Assigning metadata codes from the International Classification of Diseases (ICD) presents a standardized means of indicating diagnoses and procedures, so it turns into a necessary course of for understanding medical information to make higher scientific and monetary selections. Such a guide encoding process is time-consuming, error-prone and costly. In this paper, we proposed a deep studying strategy and a medical subject mining technique to mechanically predict ICD codes from text-free medical information. The end result of the F1 rating on MIMIC will increase by 5% over the state of artwork.

 Immuno-Informatics Quest against COVID-19/SARS-COV-2: Determining Putative T-Cell Epitopes for Vaccine Prediction

Natural Product Databases and Tools for Anti-Cancer Drug Discovery

Throughout the ages, compounds collected and/or remoted from pure sources have been the essential supply of medicinal brokers in opposition to selection of ailments. The knowledge generated from the in depth experimentation from research labs from all around the world has variety and complexity and the difficult process for database creators is to retailer, signify and trade this knowledge. The pure product database is required to be simply accessible for supporting drug discovery efforts. A potential resolution for that is supplied by chemical databases primarily based on bio- and chem-informatics approaches. Some of the anti-cancer pure product databases together with the instruments required for creating and accessing the data is mentioned right here.
Effectiveness in lab workflows-despite progresses made in automation and lab informatics-is usually hindered by inadequate integration of units and knowledge. The iLAB software program framework, a middleware connecting and integrating units and knowledge, supplies a plugin structure that may be tailored to particular person lab environments. Integration of units is ideally primarily based on standardized knowledge and communication protocols. In addition to machine integration, course of knowledge and end result knowledge from totally different sources (e.g. readers) are transformed to a customary format and administered by a highly effective database for additional processing.

HA-Tag Rabbit pAb

T0050 1ml
EUR 920
Description: The HA tag antibody can recognize C-terminal, internal, and N-terminal HA-tag fusion proteins.

Rabbit anti DDDDK-Tag pAb

AE004 50 ul
EUR 195

Rabbit anti GST-Tag pAb

AE006 100 ul
EUR 195

Rabbit anti GFP-Tag pAb

AE011 50 ul
EUR 176

Rabbit anti V5-Tag pAb

AE022 50 ul
EUR 256

Rabbit anti HA-Tag pAb

AE036 100 ul
EUR 308

c- myc Tag Rabbit pAb

T0045 100 ug
EUR 438

Histidine-tag (poly-His/Hisx6) Protein (His-tag-fusion protein) ELISA Kit, 96 tests, Quantitative

800-440-HIS 1 kit
EUR 895

TRDN protein (Rabbit) (His tag)

80R-3445 50 ug
EUR 257
Description: Purified recombinant TRDN protein (Rabbit) (His tag)

His Tag Rabbit Polyclonal Antibody

A02051-005ml 0.05ml
EUR 147
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of His Tag from Null. This His Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

His Tag Rabbit Polyclonal Antibody

A02051-02ml 0.2ml
EUR 332
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of His Tag from Null. This His Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

His Tag Rabbit Polyclonal Antibody

A02051-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of His Tag from Null. This His Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

His Tag Rabbit Polyclonal Antibody

A02051HRP-005ml 0.05ml
EUR 180
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of His Tag from Null. This His Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

His Tag Rabbit Polyclonal Antibody

A02051HRP-02ml 0.2ml
EUR 398
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of His Tag from Null. This His Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

His Tag Rabbit Polyclonal Antibody

A02051HRP-02ml5 0.2ml×5
EUR 1265
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of His Tag from Null. This His Tag antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in rabbit by using as an immunogen synthetic peptide

Rabbit anti Myc-Tag pAb-C-terminal

AE009 100 ul
EUR 228

V5-Tag pAb

AE071 50 ul
EUR 176

Anti- His-Tag Rabbit Monoclonal Antibody

EUR 370

HIS-O2 Rabbit pAb

A18124-100ul 100 ul
EUR 308

HIS-O2 Rabbit pAb

A18124-200ul 200 ul
EUR 459

HIS-O2 Rabbit pAb

A18124-20ul 20 ul
EUR 183

HIS-O2 Rabbit pAb

A18124-50ul 50 ul
EUR 223

Histidine Tag (His-Tag) Antibody

abx412016-01mg 0.1 mg
EUR 495
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody

abx413027-1mg 1 mg
EUR 815
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody

abx413031-2mg 2 mg
EUR 1483
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody

abx413032-01mg 0.1 mg
EUR 411
  • Shipped within 1 week.

His-Tag HRP-Conjugated Antibody, Rabbit Polyclonal

Ab2005-100 100ug
EUR 523

DDDDK-Tag Rabbit mAb

AE063 50 ul
EUR 223

Myc-Tag Rabbit mAb

AE070 50 ul
EUR 223

PDHE2 protein (GST tag) (His tag)

80-1378 1 mg
EUR 565
Description: PDHE2 protein (GST tag) (His tag)

SLA protein (GST tag) (His tag)

80-1380 1 mg
EUR 597
Description: Purified recombinant SLA protein (GST tag) (His tag)

TROVE2 protein (GST tag) (His tag)

80-1383 1 mg
EUR 619
Description: Purified recombinant TROVE2 (Ro60) protein (GST tag) (His tag)

Histidine Tag (His-Tag) Antibody (Biotin)

abx412017-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody (FITC)

abx412018-01mg 0.1 mg
EUR 495
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody (AP)

abx413028-01mg 0.1 mg
EUR 592
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody (Biotin)

abx413029-01mg 0.1 mg
EUR 676
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody (FITC)

abx413030-01mg 0.1 mg
EUR 592
  • Shipped within 1 week.

Histidine Tag (His-Tag) Antibody (HRP)

abx413033-01mg 0.1 mg
EUR 676
  • Shipped within 1 week.

His Tag antibody

20R-1768 100 ug
EUR 673
Description: Rabbit polyclonal His Tag antibody

His Tag antibody

20R-HC001 100 ug
EUR 435
Description: Chicken polyclonal His Tag antibody

His Tag antibody

70R-10654 400 ul
EUR 531
Description: Chicken polyclonal His Tag antibody

His Tag antibody

70R-10655 100 ul
EUR 531
Description: Chicken polyclonal His Tag antibody

His Tag antibody

70R-12241 100 ug
EUR 460
Description: Rabbit polyclonal His Tag antibody

His Tag antibody

10R-2936 100 ug
EUR 170
Description: Mouse monoclonal His Tag antibody

His Tag antibody

10R-P134a 1 mg
EUR 489
Description: Mouse monoclonal His Tag antibody

His Tag antibody

10R-10265 100 ug
EUR 251
Description: Mouse monoclonal His Tag antibody

His Tag antibody

10R-10457 100 ug
EUR 435
Description: Mouse monoclonal His Tag antibody

His Tag antibody

10R-10576 100 ug
EUR 349
Description: Mouse monoclonal His Tag antibody

His Tag antibody

10R-6750 100 ug
EUR 716
Description: Mouse monoclonal His Tag antibody

His Tag antibody

10R-7248 50 ul
EUR 133
Description: Mouse monoclonal His Tag antibody

His Tag antibody

10R-8045 100 ug
EUR 470
Description: Mouse monoclonal His Tag antibody

His-Tag Antibody

EUR 354

His-Tag Antibody

EUR 146

His-tag Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.05% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against His-tag. Recognizes His-tag from . This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/1000-1/3000.ELISA:1/20000

His-Tag Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against His-Tag. Recognizes His-Tag from . This antibody is Unconjugated. Tested in the following application: WB;WB:1:5000

His Tag antibody

70R-HR005 100 ug
EUR 381
Description: Affinity purified Rabbit polyclonal His Tag antibody

His Tag antibody

70R-PR008 100 ul
EUR 404
Description: Affinity purified Rabbit polyclonal His Tag antibody

His Tag antibody

70R-41556 100 ug
EUR 436
Description: Purified Rabbit polyclonal His Tag antibody

His tag antibody

70R-51947 100 ul
EUR 190
Description: Purified Polyclonal His tag antibody

His tag antibody

70R-32863 100 ug
EUR 457
Description: Rabbit polyclonal His tag antibody

His tag antibody

70R-32865 100 ug
EUR 349
Description: Rabbit polyclonal His tag antibody

His Tag Antibody

  • EUR 258.00
  • EUR 356.00
  • EUR 175.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

His Tag Antibody

  • EUR 314.00
  • EUR 411.00
  • EUR 258.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

His Tag Antibody

abx018240-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

His Tag Antibody

abx018241-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

His Tag Antibody

  • EUR 321.00
  • EUR 105.00
  • 100 ug
  • 10 ug
  • Shipped within 5-10 working days.

His Tag Antibody

abx037944-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

His Tag Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

His Tag Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

His Tag Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

His Tag Antibody

  • EUR 523.00
  • EUR 940.00
  • EUR 356.00
  • 0.2 mg
  • 0.5 mg
  • 100 ug
  • Shipped within 5-10 working days.

His Tag Antibody

abx034625-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

His Tag Antibody

abx034625-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

His Tag Antibody

abx034633-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

His Tag Antibody

abx034633-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

His Tag Antibody

abx034636-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

His Tag Antibody

abx034636-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

His-Tag Antibody

  • EUR 328.00
  • EUR 272.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

His-Tag Antibody

  • EUR 328.00
  • EUR 272.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

His-Tag Antibody

  • EUR 328.00
  • EUR 272.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

His-Tag Antibody

  • EUR 328.00
  • EUR 272.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

BirA, His tag

E410A24-50 50μg
EUR 694

VSVG, His tag

E410A27-5 5μg
EUR 694

EGFP, His tag

E410A28-100 100μg
EUR 434

His-tag Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

His-Tag Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.


LF-MA20209 50 ul
EUR 334
Description: Mouse monoclonal to His-Tag

Transthyrectin, his tag

LF-P0426 0.5 mg
EUR 202
Description: Transthyrectin, his tag protein


LF-PA20210 100 ul
EUR 334
Description: Rabbit polyclonal to His-Tag

His-Tag Antibody

T0009 1ml
EUR 920
Description: His-Tag Mouse Monoclonal antibody detects endogenous levels of internal, C-terminal, or N-terminal 6His -tagged proteins.

Rabbit Anti-poly His-Tag IgG- DyLight800 conjugate

HISP18-DY8 100 ul
EUR 408

Rabbit Anti-T7 tag (T7-tag, fusion tag) IgG, aff pure

T711-A 100 ul
EUR 482

Rabbit Anti-T7 tag (T7-tag, fusion tag) IgG-HRP Conjugate

T711-HRP 50 ul
EUR 408

Purified his-tag peptide (His)6 or His-tag peptide

HISP11-P 100 ug
EUR 164

Rabbit Anti-Poly-His (6xhis) (His-tag) IgG-IR700DX conjugate

HISP17-IR7 100 ul
EUR 408

Recombinant (E.Coli, His-tag) Human Syndecan-4, His-tag

RP-993 10 ug
EUR 225
Data from screening experiments and offline knowledge are visualized, analyzed, and in contrast. A filter algorithm permits looking for matching parameters in experiments in addition to the comparability of correlated datasets, independently from the used bioreactor system. The database mannequin allows the consolidation of knowledge, the transition from knowledge to info, and a strong base for administration selections on enterprise stage.

Measuring What Matters: How the Laboratory Contributes Value in the Opioid Crisis

Measuring What Matters: How the Laboratory Contributes Value in the Opioid Crisis
With over 20 years of the opioid disaster, our collective response has developed to deal with the ongoing wants associated to the administration of opioid use and opioid use dysfunction. There has been an rising recognition of the want for standardized metrics to judge organizational administration and stewardship. The medical laboratory, with a wealth of goal and quantitative well being data, is uniquely poised to help opioid stewardship and drive invaluable metrics for opioid prescribing practices and opioid use dysfunction (OUD) administration.
To establish laboratory-related insights that help these affected person populations, a group of 5 unbiased establishments, underneath the umbrella of the Clinical Laboratory 2.Zero motion, developed and prioritized metrics. Using a structured knowledgeable panel evaluate, laboratory consultants from 5 establishments assessed attainable metrics as to their relative significance, usability, feasibility, and scientific acceptability based mostly on the National Quality Forum standards. The medical insights and standardized metrics derived from the medical laboratory throughout the opioid disaster exemplifies the worth proposition of medical laboratories shifting right into a extra energetic function in the healthcare system.
A complete of 37 metrics spanning the matters of ache and substance use dysfunction (SUD) administration have been developed with consideration of how laboratory insights can impression medical care. Monitoring these metrics, in the type of summative studies, dashboards, or embedded in laboratory studies themselves might help the medical care groups and well being programs in addressing the opioid disaster. This elevated participation by the medical laboratories might enhance affected person security and cut back healthcare prices associated to OUD and ache administration.

Clinical idea extraction utilizing transformers

The aim of this research is to discover transformer-based fashions (eg, Bidirectional Encoder Representations from Transformers [BERT]) for medical idea extraction and develop an open-source bundle with pretrained medical fashions to facilitate idea extraction and different downstream pure language processing (NLP) duties in the medical area. We systematically explored Four extensively used transformer-based architectures, together with BERT, RoBERTa, ALBERT, and ELECTRA, for extracting varied kinds of medical ideas utilizing three public datasets from the 2010 and 2012 i2b2 challenges and the 2018 n2c2 problem. We examined basic transformer fashions pretrained utilizing basic English corpora in addition to medical transformer fashions pretrained utilizing a medical corpus and in contrast them with an extended short-term reminiscence conditional random fields (LSTM-CRFs) mode as a baseline.
Furthermore, we built-in the Four medical transformer-based fashions into an open-source bundle. The RoBERTa-MIMIC mannequin achieved state-of-the-art efficiency on three public medical idea extraction datasets with F1-scores of 0.8994, 0.8053, and 0.8907, respectively. Compared to the baseline LSTM-CRFs mannequin, RoBERTa-MIMIC remarkably improved the F1-score by roughly 4% and 6% on the 2010 and 2012 i2b2 datasets. This research demonstrated the effectivity of transformer-based fashions for medical idea extraction. Our strategies and programs may be utilized to different medical duties. The medical transformer bundle with Four pretrained medical fashions is publicly available. We consider this bundle will enhance present follow on medical idea extraction and different duties in the medical area.
Implementation classes: Establishing a shared ‘hub-and-spoke,’ web-based medical choice help system (CDSS) in an EHR shared by >600 group well being facilities incurred a myriad of challenges, that are summarized right here to information others in search of to make use of comparable CDSS. Legal and compliance challenges concerned guaranteeing safe information exchanges, figuring out which entity maintains information information, and deciding which information are despatched to the CDSS. Clinical implementation challenges concerned figuring out optimum methods for producing information on CDSS use charges, modifying the CDSS performance for acquiring clinician/employees suggestions, and customizing the danger thresholds that set off the CDSS for the new setting.
 Measuring What Matters: How the Laboratory Contributes Value in the Opioid Crisis

Use of ICD-10 analysis codes to establish seropositive and seronegative rheumatoid arthritis when lab outcomes should not available

Rheumatoid issue (RF) and anti-cyclic citrullinated peptide (CCP) antibody checks are sometimes measured at the time of rheumatoid arthritis (RA) analysis however will not be repeated and due to this fact not available in digital well being report (EHR) information; lab check outcomes are unavailable in most administrative claims databases. ICD10 coding permits discrimination between rheumatoid issue constructive (M05) (“seropositive”) and seronegative (M06) sufferers, however the validity of those codes has not been examined.

Growth differentiation factor 15 (GDF15) polyclonal antibody

ABP-PAB-10692 100 ug Ask for price
    • Product line: Cytokines, Chemokines, Growth Factors
    • Brand:

Rabbit Growth Differentiation Factor 15 ELISA kit

E04G0127-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 15 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 15 ELISA kit

E04G0127-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 15 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Growth Differentiation Factor 15 ELISA kit

E04G0127-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Growth Differentiation Factor 15 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

abx330969-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

abx432737-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Growth Differentiation Factor 15 (GDF15) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Leu30~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Growth Differentiation Factor 15 (GDF15)

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (His193~Val296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Growth Differentiation Factor 15 (GDF15)

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Ser189~Ala303)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Growth Differentiation Factor 15 (GDF15)

GDF-15 ELISA Kit| Rabbit Growth Differentiation Factor 15 ELISA

EF016895 96 Tests
EUR 689

Rabbit Growth Differentiation Factor 15 (GDF15) ELISA Kit

abx257429-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human, Rat)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Ala195~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Growth Differentiation Factor 15 (GDF15)

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Leu30~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Growth Differentiation Factor 15 (GDF15). This antibody is labeled with APC.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Leu30~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Growth Differentiation Factor 15 (GDF15). This antibody is labeled with Biotin.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Leu30~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Growth Differentiation Factor 15 (GDF15). This antibody is labeled with Cy3.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Leu30~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Growth Differentiation Factor 15 (GDF15). This antibody is labeled with FITC.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Leu30~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Growth Differentiation Factor 15 (GDF15). This antibody is labeled with HRP.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (Leu30~Ile308)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Growth Differentiation Factor 15 (GDF15). This antibody is labeled with PE.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (His193~Val296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Growth Differentiation Factor 15 (GDF15). This antibody is labeled with APC.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (His193~Val296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Growth Differentiation Factor 15 (GDF15). This antibody is labeled with Biotin.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GDF15 (His193~Val296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Growth Differentiation Factor 15 (GDF15). This antibody is labeled with Cy3.

Growth Differentiation Factor 15 (GDF15) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00