Inferring multimodal latent topics from electronic health records

Electronic health records (EHR) are wealthy heterogeneous collections of affected person health data, whose broad adoption gives clinicians and researchers unprecedented alternatives for health informatics, disease-risk prediction, actionable scientific suggestions, and precision drugs. However, EHRs current a number of modeling challenges, together with extremely sparse knowledge matrices, noisy irregular scientific notes, arbitrary biases in billing code project, diagnosis-driven lab checks, and heterogeneous knowledge varieties. To handle these challenges, we current MixEHR, a multi-view Bayesian subject mannequin. We exhibit MixEHR on MIMIC-III, Mayo Clinic Bipolar Disorder, and Quebec Congenital Heart Disease EHR datasets.

Qualitatively, MixEHR illness topics reveal significant combos of scientific options throughout heterogeneous knowledge varieties. Quantitatively, we observe superior prediction accuracy of diagnostic codes and lab take a look at imputations in comparison with the state-of-art strategies. We leverage the inferred affected person subject mixtures to categorise goal illnesses and predict mortality of sufferers in crucial circumstances. In all comparability, MixEHR confers aggressive efficiency and divulges significant disease-related topics.

The explosive progress of machine studying has offered scientists with insights into knowledge in methods unattainable utilizing prior analysis methods. It has allowed the detection of organic options that had been beforehand unrecognized and missed. However, as a result of machine-learning methodology originates from informatics, many cell biology labs have skilled difficulties in implementing this strategy.

In this text, we goal the quickly increasing viewers of cell and molecular biologists thinking about exploiting machine studying for evaluation of their analysis. We focus on the benefits of using machine studying with microscopy approaches and describe the machine-learning pipeline. We additionally give sensible tips for constructing fashions of cell conduct utilizing machine studying. We conclude with an summary of the instruments required for mannequin creation, and share recommendation on their use.

Cloud-Based System for Effective Surveillance and Control of COVID-19: Useful Experiences From Hubei, China.

Coronavirus illness (COVID-19) has been an unprecedented problem to the worldwide health care system. Tools that may enhance the main focus of surveillance efforts and scientific resolution help are of paramount significance. To illustrate how new medical informatics applied sciences will allow efficient management of the pandemic, the Honghu Hybrid System (HHS) for COVID-19 was developed and efficiently deployed inside 72 hours within the metropolis of Honghu in Hubei, China.

The HHS was designed for the gathering, integration, standardization, and evaluation of COVID-19-related knowledge from a number of sources, which features a case reporting system, diagnostic labs, electronic medical records, and social media on cellular units. HHS helps 4 most important options: syndromic surveillance on cellular units, policy-making resolution help, scientific resolution help and prioritization of assets, and follow-up of discharged sufferers.

The syndromic surveillance part in HHS coated over 95% of the inhabitants of over 900,000 individuals and offered close to actual time proof for the management of epidemic emergencies. The scientific resolution help part in HHS was additionally offered to enhance affected person care and prioritize the restricted medical assets. However, the statistical strategies nonetheless require additional evaluations to verify scientific effectiveness and appropriateness of disposition assigned on this examine, which warrants additional investigation. The facilitating elements and challenges are mentioned to offer helpful insights to different cities to construct appropriate options primarily based on cloud applied sciences.

The HHS for COVID-19 was proven to be possible and efficient on this real-world subject examine, and has the potential to be migrated. The explosive progress of machine studying has offered scientists with insights into knowledge in methods unattainable utilizing prior analysis methods. It has allowed the detection of organic options that had been beforehand unrecognized and missed. However, as a result of machine-learning methodology originates from informatics, many cell biology labs have skilled difficulties in implementing this strategy.

In this text, we goal the quickly increasing viewers of cell and molecular biologists thinking about exploiting machine studying for evaluation of their analysis. We focus on the benefits of using machine studying with microscopy approaches and describe the machine-learning pipeline. We additionally give sensible tips for constructing fashions of cell conduct utilizing machine studying. We conclude with an summary of the instruments required for mannequin creation, and share recommendation on their use.

 Immuno-Informatics Quest against COVID-19/SARS-COV-2: Determining Putative T-Cell Epitopes for Vaccine Prediction

Emerging Technologies to Bring Glycoproteomics Within Reach.

The NIH Common Fund Glycoscience program develops accessible and inexpensive new instruments for carbohydrate evaluation, informatics, and synthesis. The program emphasizes simple applied sciences attentive to wants expressed by finish person teams from a number of fields. Validation and value testing in partnering labs ensures that instruments are accessible to non-specialists. This session will describe instruments rising from the Glycoscience program and clarify how useful resource services can entry these instruments and convey them in-house. Our aim is for assets to broaden their impression in glycomics, glycoproteomics, and glycoscience usually, by adoption of simple, dependable artificial, analytical, and informatics instruments that we’re growing.

Three Scientific Sessions will describe instruments rising from the Glycoscience program, in three classes: (1) glycan evaluation, together with mass spectrometric methods for construction willpower and glycoproteomics; (2) glycan synthesis; and (3) glycoinformatics. Analytical applied sciences to be described embrace: excessive throughput permethylation of glycopeptides by way of one-pot for website mapping and glycan evaluation

Isotope-targeted glycoproteomics (IsoTaG), a mass-independent chemical glycoproteomics method for profiling glycopeptides, figuring out each N- and O-glycan constructions and websites of attachment in advanced samples; facile strategies to extremely purify glycans; software program instruments for constructing 3D fashions of glycoproteins and predicting the 3D construction of glycans; a variety of extremely versatile glycan affinity reagents, together with sialoglycan-recognizing probes; and new photo-crosslinking probes for discovery of the interplay companions of O-GlcNAc modified proteins.

ABHD1 Polyclonal Antibody

ABP57663-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABHD1 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of ABHD1 from Human, Mouse, Rat. This ABHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABHD1 protein at amino acid sequence of 220-300

ABHD1 Polyclonal Antibody

ES9333-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABHD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABHD1 Polyclonal Antibody

ES9333-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABHD1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Abhd1/ Rat Abhd1 ELISA Kit

ELI-49473r 96 Tests
EUR 886

Polyclonal ABHD1 Antibody (C-term)

APR04321G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ABHD1 (C-term). This antibody is tested and proven to work in the following applications:

ABHD1 Antibody

36009-100ul 100ul
EUR 252

ABHD1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABHD1. Recognizes ABHD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ABHD1 Antibody

DF9140 200ul
EUR 304
Description: ABHD1 Antibody detects endogenous levels of total ABHD1.

ABHD1 antibody

70R-8853 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ABHD1 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABHD1 Antibody

ABD9140 100 ug
EUR 438


YF-PA21459 50 ug
EUR 363
Description: Mouse polyclonal to ABHD1

ABHD1 Blocking Peptide

33R-3428 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABHD1 antibody, catalog no. 70R-8853

ABHD1 Blocking Peptide

DF9140-BP 1mg
EUR 195

ABHD1 Conjugated Antibody

C36009 100ul
EUR 397

ABHD1 cloning plasmid

CSB-CL842760HU-10ug 10ug
EUR 451
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1218
  • Sequence: atgctgagctccttcctgagcccccagaatggcacctgggcagacaccttctctctgctcttggctcttgccgttgccctctacttgggctactactgggcatgtgtgcttcagaggcctcggctggtggctgggccgcagtttctggccttcctggagccacactgttccatca
  • Show more
Description: A cloning plasmid for the ABHD1 gene.

anti- ABHD1 antibody

FNab00044 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: abhydrolase domain containing 1
  • Uniprot ID: Q96SE0
  • Gene ID: 84696
  • Research Area: Metabolism
Description: Antibody raised against ABHD1

Anti-ABHD1 antibody

PAab00044 100 ug
EUR 386

Anti-ABHD1 antibody

STJ190491 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABHD1


EF007535 96 Tests
EUR 689

Rat ABHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ABHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABHD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


PVT16780 2 ug
EUR 325

ABHD1 Recombinant Protein (Human)

RP000115 100 ug Ask for price

ABHD1 Recombinant Protein (Mouse)

RP113426 100 ug Ask for price

ABHD1 Recombinant Protein (Rat)

RP188639 100 ug Ask for price

Rabbit Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E04A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E04A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E04A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Abhd1 ORF Vector (Rat) (pORF)

ORF062881 1.0 ug DNA
EUR 506

ABHD1 ORF Vector (Human) (pORF)

ORF000039 1.0 ug DNA
EUR 95

Abhd1 ORF Vector (Mouse) (pORF)

ORF037810 1.0 ug DNA
EUR 506

Abhydrolase Domain Containing 1 (ABHD1) Antibody

abx030344-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Abhydrolase Domain Containing 1 (ABHD1) Antibody

abx030344-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Abhydrolase Domain Containing 1 (ABHD1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Abhydrolase Domain Containing 1 (ABHD1) Antibody

abx230044-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Abhd1 sgRNA CRISPR Lentivector set (Rat)

K7243701 3 x 1.0 ug
EUR 339

ABHD1 sgRNA CRISPR Lentivector set (Human)

K0022101 3 x 1.0 ug
EUR 339

Abhd1 sgRNA CRISPR Lentivector set (Mouse)

K3896901 3 x 1.0 ug
EUR 339

Abhd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7243702 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7243703 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7243704 1.0 ug DNA
EUR 154

ABHD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0022102 1.0 ug DNA
EUR 154

ABHD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0022103 1.0 ug DNA
EUR 154

ABHD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0022104 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3896902 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3896903 1.0 ug DNA
EUR 154

Abhd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3896904 1.0 ug DNA
EUR 154

ABHD1 Protein Vector (Mouse) (pPB-C-His)

PV151238 500 ng
EUR 603

ABHD1 Protein Vector (Mouse) (pPB-N-His)

PV151239 500 ng
EUR 603

ABHD1 Protein Vector (Mouse) (pPM-C-HA)

PV151240 500 ng
EUR 603

ABHD1 Protein Vector (Mouse) (pPM-C-His)

PV151241 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPB-C-His)

PV251522 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPB-N-His)

PV251523 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPM-C-HA)

PV251524 500 ng
EUR 603

ABHD1 Protein Vector (Rat) (pPM-C-His)

PV251525 500 ng
EUR 603

ABHD1 Protein Vector (Human) (pPB-His-MBP)

PV318890 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPB-His-GST)

PV318891 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPB-C-His)

PV000153 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPB-N-His)

PV000154 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPM-C-HA)

PV000155 500 ng
EUR 329

ABHD1 Protein Vector (Human) (pPM-C-His)

PV000156 500 ng
EUR 329

Abhd1 3'UTR Luciferase Stable Cell Line

TU101178 1.0 ml Ask for price

Abhd1 3'UTR GFP Stable Cell Line

TU151178 1.0 ml Ask for price

Abhd1 3'UTR Luciferase Stable Cell Line

TU200085 1.0 ml Ask for price

Abhd1 3'UTR GFP Stable Cell Line

TU250085 1.0 ml Ask for price

ABHD1 3'UTR GFP Stable Cell Line

TU050092 1.0 ml
EUR 1394

ABHD1 3'UTR Luciferase Stable Cell Line

TU000092 1.0 ml
EUR 1394

Human Abhydrolase Domain Containing 1 (ABHD1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

ABHD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV673117 1.0 ug DNA
EUR 682

ABHD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV673121 1.0 ug DNA
EUR 682

ABHD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV673122 1.0 ug DNA
EUR 682

Rat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E02A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E02A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E02A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E06A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E06A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E06A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E03A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E03A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E03A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E01A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E01A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E01A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E08A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E08A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E08A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E09A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E09A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E09A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E07A0953-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E07A0953-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Abhydrolase domain containing protein 1(ABHD1) ELISA kit

E07A0953-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Abhydrolase domain containing protein 1(ABHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Abhydrolase domain- containing protein 1, Abhd1 ELISA KIT

ELI-24638m 96 Tests
EUR 865

Bovine Abhydrolase domain- containing protein 1, ABHD1 ELISA KIT

ELI-34988b 96 Tests
EUR 928

Chemical and enzymatic schemes for the facile automated synthesis of carbohydrates (N- linked, O-linked, human milk, GAGs, glycolipids) can be found to core services to carry in-house utilizing present instrumentation or new low-cost modular automation platforms. Glycoinformatics instruments and strategies are being developed in a community-based effort, integrating them with well-established genomic and proteomic databases and instruments at NCBI and EBI. The venture entails 10 groups in 5 international locations.